Rubbi CP, Milner J
October 18, 2024Rubbi CP, Milner J. FBS. MCF10A and HMEC cells were cultivated in MEGM medium with MEGM SingleQuots growth factors (Lonza). Cells were incubated at 37C inside a humidified PD 198306 incubator with 5% CO2 and transfected with Fugene 6 (Roche), Lipofectamine2000 (Invitrogen) or Oligofectamine (Invitrogen). Cell lines were validated by STR DNA fingerprinting using the AmpF?STR Identifiler kit according to manufacturer instructions (Applied Biosystems cat 4322288). The STR profiles were compared to known ATCC fingerprints, to the Cell Collection Integrated Molecular Authentication database (CLIMA) version 0.1.200808 (Nucleic Acids Study 37:D925-D932 PMCID: PMC2686526 and to the MD Anderson fingerprint database (22, 23). The STR profiles matched known DNA fingerprints or were unique. Plasmids To generate FLAG-ZNF668, V5-ZNF668, and GST-ZNF668 constructs, full-length ZNF668 cDNA was amplified by PCR and subcloned into pCMV5-3 FLAG vector (Sigma), pLenti4/TO/V5-DEST vector (Invitrogen), and pGEX-4T vector (Addgene). The R556Q (Mutant 1) and A66T (Mutant 2) point mutations were created from 3 FLAG-ZNF668 using the GeneTailor Site-Directed Mutagenesis System (Invitrogen). The FLAG-tagged ZNF668 deletion mutants ZNF668- 1~ 12 were generated by PCR PD 198306 and subcloned into 3 FLAG vector. FLAG-p53 (108038, pcDNA3 FLAG-p53), GST-p53 (10852, p3113 PD 198306 GST-p53), and GST-MDM2 (16237, pGEX-4T MDM2 wild-type) were from Addgene. MDM2 deletion plasmids 58-89, 212-296, 222-437, 296-437, and 9 (RING finger website deletion) were kind gifts from Dr. Karen Vousdens (The Beatson Institute for Malignancy study). The identity of the plasmids was confirmed by sequencing in the MD Anderson Malignancy Center DNA Analysis Core Facility. Antibodies and Reagents Nucleotides (548-1449) were subcloned into pGEX-4T and the protein product was utilized for immunization for anti-ZNF668 antibody (Proteintech Group, Inc.). Anti-FLAG M2-agarose affinity gel was from Sigma. Anti-p53 (FL-393), anti-MDM2 (SMP14), anti-NPM (C-19), anti-p53 (FL393), anti-p53-HRP (SC-126) and anti-p21(C-19) were from Santa Cruz Biotechnology. Anti-p53 (DO-1) was from Calbiochem. Anti-phospho-p53CSer15 was from Cell Signaling. Anti-ubiquitin (FK2) and an ubiquitinylation kit were from BioMol. Anti-NS (MAB4311) was from Chemicon. Anti-V5 (abdominal9116) and anti-NPM (abdominal10530) were from Abcam. A thrombine cleavage capture kit was from Novagen. Cycloheximide was from Sigma and used at 50 g/ml (U2OS cells) or 20 g/ml (MCF7 cells). MG132 (carbobenzoxy-L-leucyl-L-leucyl-L-leucine) was from EMD Biosciences and used at 10 M. Nutlin-3 was from Cayman Chemical and PD 198306 used at 10 M. The ON-TARGETplus ZNF668 (siRNA 1: GUGCCAGCGACUUGCGCAAUU; siRNA 2: AAGCCAUACCACUGCGAGAUU), non-targeting and HDM2 siRNA PRKAR2 smartpool were from Dharmacon. Lentiviral vector-based MISSION shRNAs focusing on ZNF668 and control were from Sigma. RNA Interference was performed by using Lipofectamine 2000 (MCF7) PD 198306 or Oligofectamine (U2OS). Immunoblotting and Immunoprecipitation Immunoblotting and Immunoprecipitation were performed as explained before (24). Cells were extracted in RIPA buffer and immunoprecipitated with specific antibodies. The immunocomplexes were collected on Protein A/G plus-conjugated agarose beads (Santa Cruz Biotechnology). The nuclear components were prepared in 20 mmol/L HEPES (pH 7.9), 1.5 mM MgCl2, 100 mM KCl, 420 mM NaCl, 0.2 mM EDTA, and 1 mM dithiothreitol. In Vitro GST-Protein Binding Assay The GST-ZNF668, GST-MDM2, and GST-p53 fusion proteins were expressed in strain BL21 and purified using glutathione agarose (Sigma). GST fusion proteins harboring p53, and MDM2 were cleaved and purified having a thrombin cleavage capture kit. Purified proteins were incubated in 300 l of binding buffer (25 mM Tris-Cl (pH 7.2), 50 mM NaCl, and 0.2% NP-40). Proteins were recovered (2 h at 4C) with glutathione agarose beads. Beads were washed extensively with washing buffer (100 mM Tris-Cl (pH 8.0), 100 mM NaCl, and 1% Nonidet P-40), eluted with 10 mg/ml reduced glutathione (pH 8.0) and subjected to European blotting analysis. In Vitro Proliferation and Soft Agar Assay proliferation assay and smooth agar assay were performed as explained before (24). To measure cell proliferation, cells were plated in 96-well plates and MTT substrate (2 mg/ml) was added into the culture medium. Four hours later on,.